| Đường dây nóng | Ban biên tập | Video Clip | Liên hệ |

Qui trình PCR phát hiện gen kháng kháng sinh

  1.  MỤC ĐÍCH:
 
          Phát hiện các gen đặc hiệu mã hóa tính kháng kháng sinh của vi khuẩn.
 
           2.    PHẠM VI ÁP DỤNG
                Phát hiện một số gen kháng kháng sinh của các vi khuẩn Gram âm từ các chủng vi khuẩn gây bệnh phân lập được từ các bệnh phẩm lâm sàng, các vụ dịch, và ở môi trường ngoại cảnh.
 
           3.    NGUYÊN TẮC
                Sử dụng các đoạn mồi đặc hiệu để khuếch đại một số đoạn gen kháng kháng sinh của vi khuẩn bằng phản ứng chuỗi men. Quá trình này được lặp lại nhiều lần để tổng hợp hàng triệu bản sao của đoạn gen từ một vài phân tử ADN ban đầu qua đó có thể phát hiện được các đoạn gen dưới đèn UV sau khi điện di.

           4.    TRÁCH NHIỆM

§ Cán bộ thực hiện:
-          Thực hiện thao tác xét nghiệm.
-          Đảm bảo các mẫu bệnh phẩm được dán nhãn đúng và ghi vào sổ nhận mẫu.
-          Hoàn tất báo cáo trả lời kết quả xét nghiệm.
-          Đảm bảo kiểm soát chất lượng nội bộ phù hợp với tiêu chuẩn.
 
§ Trưởng phòng thí nghiệm:
-          Duyệt lại các kết quả xét nghiệm.
-          Cập nhật các thay đổi của qui trình.

           5.    AN TOÀN

§ Mặc áo choàng, mang găng tay và khẩu trang khi tiếp xúc với các mẫu bệnh phẩm.
§ Mang găng tay suốt quá trình thao tác kỹ thuật PCR.

           6.    THÔNG TIN MẪU BAN ĐẦU

STT

Tên mẫu

Dụng cụ chứa

Chất thêm vào

Số lượng cần có

Yêu cấu về vân chuyễn và lưu giữ

1

Chủng vi khuẩn

Thạch mềm hoặc thạch dinh dưỡng

Không

Nhiệt độ phòng  (2-4 tuần)

           7.    TRANG THIẾT BỊ-HÓA CHẤT-SINH PHẨM

7.1. Thiết bị:

     § Máy luân nhiệt :Mastercycler eppendorf
     § Máy chụp gen
     § Máy điện di
     § Máy ly tâm eppendorf 10.000
     § Máy lắc có điều chỉnh nhiệt độ
     § Máy khuấy từ
     § Máy trộn vortex
     § Máy đo pH
     § Cân điện
     § Tủ lạnh 40C, -200C và -800C
     § Tủ ấm
   
7.2. 
Dụng cụ:
 
     § Que cấy vi khuẩn
     § Micropipette:: 2,5; 10-50; 100-200 và 1000ml
     § Đầu týp các cỡ
     § Tube eppendorf các cỡ: 0,2; 0,5; 1,5ml
     § Hộp để đầu týp
     § Giá để đầu tube
     § Ống nghiệm 12
     § Hộp lồng, bình cầu, ống đong
     § Chai 0,5lít, 1 lít
     § Găng tay các cỡ

7.3. Sinh phẩm hóa chất

          Bảng 1: Các đoạn mồi dùng trong kỹ thuật PCR phát hiện gen kháng khang sinh của vi khuẩn

STT

Thiết kế mồi

Trình tự mồi (5’-3’)

Kích thước cặp mồi (bp)

Mã hóa kháng sinh

1

dfrA1-B

TTAACCCTTTTGCCAGATTT

500

Trimmethoprim

dfrA1-F

GTGAAACTATCACTAATGG

2

TetA (classD)-B

GCAACTCTAATGCCACTGTG

1200

Tetracycline

TetA (classD)-F

TCGCTGGTAGCTTCGCTATT

3

strA-B

CCAATCGCAGATAGAAGGCAA

495

Streptomycin

strA-F

TTGATGTGGTGTCCCGCAATG

4

Sulll-B

TGTGCGGATGAAGTCAGCTCC

626

Sulfonamide

Sulll-F

AGGGGGCAGATGTGATCGAC

5

Intl-B

CTCTATGGGCACTGTCCACATTG

800

Yếu tố SXT

Intl-F

GCTGGATAGGTTAAGGGCGG

6

Tem-Fc          

TTTTCGTGTCGCCCTTATTCC

798

b-lactamase

Tem-R

CGTTCATCCATAGTTGCCTGACTC

      
7

Kp-ndm1-F

atgcacccggtcgcgaagctgag

499

Carbapenem

Kp-ndm1-R

ttcgacccagccattggcggcga

    § Canh thang LB (promega)
    § Thạch dinh dưỡng
    § NaCl 0,09%
    § Dung dịch đệm TAE 10X
    § Nước cất
    § Thạch điện di (electrophoresis agar)
    § Thang chuẩn ADN 100bp
    § Ethidiumbromide
    § Chứng dương:
            o    V. cholerae O1 VN01/07: mang các gen tet,  dfrA và  Class 1 intergron
            o    K. pneumoniae VN-17/10: mang các gen NDM-1
    § Chứng âm: E. coli không mang gen kháng kháng sinh
 
           8.    TIẾN HÀNH KỸ THUẬT PCR
 

8.1. Tách chiết ADN khuôn mẫu:

8.1.1.     Tách chiết từ chủng vi khuẩn

-          Lấy 4-5 khuẩn lạc trộn đều với 200µl nước cất.

-          Đun cách thủy ở 950C trong 5 phút.

-           Ly tâm 10.000 vòng/2 phút lấy nước nổi làm khuôn mẫu ADN.
 

8.2. Chuẩn bị hỗn hợp phản ứng PCR

8.2.1.     Cách pha mồi (primers) cho phản ứng PCR:
Bảng 2: Cách pha mồi

Primers (mồi)

Primer đặc

(100µM/µl)

Nước cất siêu sạch

Nồng độ pha loãng

Primer cần dùng cho 30µl phản ứng

dfrA1-B

10 µl

30µl

25µM/ul

1µl (1µM)

dfrA1-F

10 µl

30µl

25µM/ul

1µl (1µM)

TetA (classD)-B

10 µl

30µl

25µM/ul

1µl (1µM)

TetA (classD)-F

10 µl

30µl

25µM/ul

1µl (1µM)

strA-B

10 µl

30µl

25µM/ul

1µl (1µM)

strA-F

10 µl

30µl

25µM/ul

1µl (1µM)

Sulll-B

10 µl

30µl

25µM/ul

1µl (1µM)

Sulll-F

10 µl

30µl

25µM/ul

1µl (1µM)

Intl-B

10 µl

30µl

25µM/ul

1µl (1µM)

Intl-F

10 µl

30µl

25µM/ul

1µl (1µM)

Kp-ndm1-F

10 µl

30µl

25µM/ul

1µl (1µM)

Kp-ndm1-R

10 µl

30µl

25µM/ul

1µl (1µM)

8.2.2.     Hỗn hợp phản ứng cho PCR đơn mồi bằng Master-Mix (promega)

Thành phần phản ứng

1 mẫu (µl)

10 Mẫu (µl)

2X Master-Mix

15

150

Cặp primers

1

10

1

10

Nước siêu sạch

10

100

Tổng số:

27

270

§ Trộn đều chia mỗi tube 27µl.
§ Cho 3µl ADN khuôn mẫu vào các tube chứa hỗn dịch PCR.
 
8.3. Thực hiện phản ứng PCR trên máy luân nhiệt 
      8.3.1.     Chu trình PCR cho các gen kháng sinh: tetA. dfrA, strA, Sull và int

Các bước

Nhiệt độ

Thời gian

Biến tính

940C

 5 phút

Biến tính

950C

60 giây

Gắn mồi

550C

45 giây          30 chu kỳ

Tổng hợp

720C

1,2 phút

Kết thúc

720C

5 phút

Giữ ở nhiệt độ 40C

                  8.3.2.     Chu trình PCR cho các gen kháng sinh NDM-1

Các bước

Nhiệt độ

Thời gian

Biến tính

940C

 4 phút

Biến tính

940C

36 giây

Gắn mồi

600C

36 giây          30 chu kỳ

Tổng hợp

720C

50 giây

Kết thúc

720C

5 phút

Giữ ở nhiệt độ 40C

8.4. Điện di sản phẩm PCR

§ Chuẩn bị gel agarose 2%:
              Cần 1g thạch cho vào dung dịch TAE 1X, lắc đều và đun hòa tan thạch bằng lò vi sóng.
              Để thạch nguội khoảng 700C đổ khuôn tạo gel.
 
§ Nhỏ mẫu:
              Đặt bản gel vào buồng điện di có dung dịch đệm TAE 1X.
              Rỏ 5µl thang ADN chuẩn 100bp, các chứng âm, chứng dương và sản phẩm PCR vào các giếng thạch.

§ Chạy điện di: Chạy điện di ở hiệu điện thế 100V trong vòng 30 phút.

§ Nhuộm và chụp ảnh gel:
              Nhuộm gel trong dung dịch ethidium bromide (10mg/ml) trong 10 phút rồi rửa bằng nước cất trong 15 phút.
              Soi và chụp ảnh gel bằng máy chụp gel BioDoc-itTM System.

           9.    PHÂN TÍCH KẾT QUẢ

-          Chứng dương phải rõ ràng.
-          Có vạch trên gel và đúng kích thước khi so sánh với thang ADN chuẩn vạch có hình ảnh rõ nét, đẹp như hình 1.
 

          Hình 1: Kết quả PCR phát hiện gen NDM-1 kháng carbapenem của vi khuẩn

-          Nếu vạch mờ, không rõ:
      o    Tăng thể tích điện di.
      o    Thực hiện lại phản ứng PCR.
-          Mẫu chứng âm không được có vạch nào, nếu thấy vạch là mẫu đã bị nhiễm và phải làm lại xét nghiệm.
-          Các mẫu xét nghiệm được xác định dương tính khi xuất hiện các vạch có kích thước tương ứng với các mẫu chứng và thang chuẩn ADN, ghi: (+).
-          Các mẫu không có vạch hoặc có vạch không đúng kích thươc được coi là âm tính, ghi (-).

           10.    KIỂM TRA CHẤT LƯỢNG

-          Độ nhạy: 100vk/ml
-          Độ đặc hiệu: 100%
-          Mẫu chứng:
-          Chứng âm: E. coli (không có vạch)
-          Chứng dương:
      o    TetA: VN107-07
      o    DfrA: VN107-07
      o    StrA: VN107-07
      o    Int: VN107-07
      o    NDM-1: K. pneumoniae VN-17/10
 
 
PHIẾU TRẢ LỜI KẾT QUẢ PCR
 

  Người làm xét nghiệm:……………………………………………………………………………..

  Ngày làm xét nghiệm:………………………………………………………………………………

              1.     Loại mẫu:…………………………………………………………………………………...
              2.     Tách chiết ADN khuôn mẫu:………………………………………………………………
                   ……………………………………………………………………………………………………………………………
………………………………………………………....................
              3.     Pha hỗn hợp phản ứng PCR:

Hóa chất

Thể tích cho 1 phản ứng

Thể tích cho N phản ứng

Nồng độ cuối cùng

Nước cất

Master mix 2X

Tổng số

        4.     PCR:     Máy……………………….Chu trình………………………………………………
        5.     Điện di:Máy……… Thạch……%. Dung dịch đệm……...    Công suất…..   Thời gian…..
        6.     Chụp ảnh gel và phân tích kết quả:

STT
Tên mẫu
Kết quả
1
Chứng dương
 
2
Chứng âm
 
3
……..
 
4
……..
 
5
……..
 
6
……..
 
….
   

Cán bộ xét nghiệm
 

Trưởng khoa

Tag: qui trình pcr phát hiện gen kháng kháng sinh

Bình luận

Bạn cần phải Đăng nhập trước khi gửi bình luận.
 
Qui trình PCR phát hiện gen kháng kháng sinh Qui trình PCR phát hiện gen kháng kháng sinh
2.0/5 114